<![CDATA[
#!perl -w
use strict;
# Transcribing DNA into RNA
# The DNA
my $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
# Print the DNA onto the screen
print "Here is the starting DNA:\n";
print_dna($DNA);
# Print the RNA onto the screen
print "Result of transcribing the DNA to RNA:\n";
print_dna(dna2rna($DNA));
# Successful Exit
exit 0;
# Transcribe the DNA to RNA by substituting all T's with U's.
sub dna2rna {
my $rna = shift;
$rna =~ s/T/U/g;
return $rna;
}
# sub to print the DNA onto the screen
sub print_dna {
my $dna = shift;
print $dna,"\n";
}
]]>