<![CDATA[
#!perl -w
use strict;
# Calculating the reverse complement of a strand of DNA
# The DNA
my $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
print "Starting DNA:\n";
print_dna($DNA);
print "Reverse Complement of DNA:\n";
print_dna( revcom($DNA) );
# Successful exit
exit(0);
# Calculate the reverse complement
sub revcom {
my $dna = shift;
# Make a new copy of the DNA (see why we saved the original?)
my $revcom = reverse $dna;
# See the text for a discussion of tr///
$revcom =~ tr/ACGTacgt/TGCAtgca/;
return $revcom;
}
# sub to print the DNA onto the screen
sub print_dna {
my $dna = shift;
print $dna,"\n";
}
]]>