<![CDATA[
#!perl -w
use strict;
# documentation written in pod, perldoc perlpod
=head1 NAME
Seq.pm
=head1 DESCRIPTION
Seq Object definition and methods for sequences.
=head1 SYNOPSIS
use Seq;
my $seq = new Seq("CATTAGGCTAATAATAAAAA");
=head1 USAGE
my $dna = $seq->concatenate("CATGCCTAAAATA");
my $rna = $seq->dna2rna( );
my $seq = $seq->revcom( );
print $seq->print_dna( );
=head1 NOTES
Sequences can be nucleotides and proteins.
They may manipulate with various utilities.
=head1 AUTHOR
David Scott
=head1 METHODS
Method documentation follows:
=over 4
=cut
package Seq;
use SeqFun qw/slurp/;
# constructors
=item my $seq = Seq->new("CATG");
=item my $seq = new Seq("CATG");
=item my $seq = Seq->new($dna);
=item my $seq = new Seq($dna);
=item my $seq2 = $seq->new($dna);
Creates a sequence from the 1st argument. DEFAULT is "".
=cut
sub new {
my ($self) = shift;
# force a valid classname for objects
my $class = ref($self) || $self;
$self = { seq => shift || "", filename => "" };
return bless($self, $class);
}
=item my $seq = Seq->read("hox.dna");
=item my $seq = Seq::read Seq("hox.dna");
=item my $seq = Seq->read($filename);
=item my $seq = Seq::read Seq($filename);
=item my $seq2 = $seq->read($filename);
Creates a sequence from the $filename. DEFAULT is "".
=cut
sub read {
my ($self) = shift;
my $class = ref($self) || $self;
$self = { seq => "", filename => shift || "" };
my $ref = slurp($self->{filename});
$self->{seq} = $$ref; # copy data in
return bless($self, $class);
}
# object methods
=item my $mySeq = $seq->concatenate($dna1, $dna2, ... );
Return a Seq object which concatenates any dna sequences
passed in to this Seq object.
=cut
sub concatenate {
my ($self, @dna) = @_;
my $result = $self->{seq};
foreach (@dna) {
$result .= $_;
}
return Seq->new($result);
}
=item my $rna = $dna->dna2rna();
Return a Seq object that is rna, transcribe the DNA to RNA
by substituting all T's with U's.
=cut
sub dna2rna {
my $self = shift;
my $rna = $self->{seq};
$rna =~ s/T/U/g;
return Seq->new($rna);
}
=item my $text = $seq->print_dna();
return text of dna.
=cut
sub print_dna {
my $self = shift;
return $self->{seq} . "\n";
}
=item my $seq = $dna->revcom()
Return a Seq object that is the reverse complement of the $dna
sequence.
=cut
sub revcom {
my $self = shift;
my $revcom = reverse $self->{seq};
$revcom =~ tr/ACGTacgt/TGCAtgca/;
return new Seq->new($revcom);
}
1; # successful -- library loaded
]]>