<![CDATA[
#!perl -w
use strict;
use Shell qw(dir);
my $command = "dir *.txt";
print "Executing a shell command, $command\n";
my $text = `$command`;
print "DIR back tics:\n$text\n";
$text = qx/$command/;
print "DIR qx command:\n$text\n";
print "DIR system output:\n";
system("$command");
$text = dir("*.txt");
print "DIR Shell library:\n$text\n";
my $poly_a_tail_search = qr/a{2,}ta{3,}/io;
my $sequence = "GACTCATCATAATAAAAAAAAATAGCATCATCATAATAAAAA";
# process this set of genes
@ARGV = ( "pccx1.dna" ) if scalar @ARGV < 0;
while ( $sequence =~ /$poly_a_tail_search/ ) {
my $count = 0;
while ($sequence =~ /$poly_a_tail_search/g) { ++$count; }
print "Number of poly a tails: ", $count, "\n";
$sequence = next_sequence();
}
my @array = ();
print 'Empty @array means $#array is: ', $#array, "\n";
print 'Empty @array means scalar @array is: ', scalar @array, "\n";
@array = ("one");
print 'One item in @array means $#array is: ', $#array, "\n";
print 'One item in @array means scalar @array is: ', scalar @array, "\n";
@ARGV = ( "pccx1.dna" ) if scalar @ARGV < 0;
exit(1) unless scalar @ARGV > 0;
my $count = 0;
while ( <> ) {
while ( /$poly_a_tail_search/g ) { ++$count; }
if ( eof ) {
print "File: ", $ARGV, "\tNumber of poly a tails: ", $count, "\n";
$count = 0;
}
}
sub next_sequence {
return "";
}
exit(0);
]]>